ID: 986694410_986694420

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 986694410 986694420
Species Human (GRCh38) Human (GRCh38)
Location 5:10339317-10339339 5:10339354-10339376
Sequence CCCAGCGTGATGGCCATGGATGA CCCCATTTTGCTGTTGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 53} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!