ID: 986697738_986697743

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 986697738 986697743
Species Human (GRCh38) Human (GRCh38)
Location 5:10373639-10373661 5:10373656-10373678
Sequence CCGTCACGATGTTCCTGGAGGGC GAGGGCAGCGTCCCACGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 87} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!