ID: 986703913_986703922

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 986703913 986703922
Species Human (GRCh38) Human (GRCh38)
Location 5:10439826-10439848 5:10439862-10439884
Sequence CCATCACCTCTGTGTTCACCCTG CCCTGCCTCCAAAACAGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 349} {0: 1, 1: 0, 2: 1, 3: 18, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!