ID: 986712972_986712977

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 986712972 986712977
Species Human (GRCh38) Human (GRCh38)
Location 5:10501341-10501363 5:10501366-10501388
Sequence CCTCTTCTGTGAGGGTCCCTGGA CAGTGGCTGCTCCCTGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 273} {0: 1, 1: 0, 2: 1, 3: 51, 4: 436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!