ID: 986718464_986718475

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 986718464 986718475
Species Human (GRCh38) Human (GRCh38)
Location 5:10540880-10540902 5:10540933-10540955
Sequence CCAAAGTGCTAGAATTACAGATG TTTAAAATGCAGATGGTACAGGG
Strand - +
Off-target summary {0: 34, 1: 1229, 2: 16909, 3: 107983, 4: 239040} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!