ID: 986732554_986732560

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 986732554 986732560
Species Human (GRCh38) Human (GRCh38)
Location 5:10645906-10645928 5:10645958-10645980
Sequence CCACGTCTGTAGACATTTTTGGT CTAGAAGAAGGTAGAGATCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 31, 3: 82, 4: 223} {0: 1, 1: 0, 2: 0, 3: 23, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!