ID: 986744193_986744198

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 986744193 986744198
Species Human (GRCh38) Human (GRCh38)
Location 5:10730176-10730198 5:10730225-10730247
Sequence CCTGTGAGAAGAGGGATTTTGTT TAGAGTACCTGGCACAGACGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 21, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!