ID: 986788783_986788789

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 986788783 986788789
Species Human (GRCh38) Human (GRCh38)
Location 5:11140592-11140614 5:11140616-11140638
Sequence CCAGTTCCTACTGTGATGTCAAA ACATGGGAAGAGAGGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!