ID: 986802322_986802329

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 986802322 986802329
Species Human (GRCh38) Human (GRCh38)
Location 5:11274972-11274994 5:11275013-11275035
Sequence CCTAGGGTGTTTCACCAATGTTA TAGAGTTGGTAGGAAGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 167} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!