ID: 986802495_986802499

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 986802495 986802499
Species Human (GRCh38) Human (GRCh38)
Location 5:11276654-11276676 5:11276706-11276728
Sequence CCTTATTTGAAAGCAGTGCGTTT GAGGAAATCATCCTGGATTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 212} {0: 1, 1: 2, 2: 34, 3: 135, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!