ID: 986803631_986803633

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 986803631 986803633
Species Human (GRCh38) Human (GRCh38)
Location 5:11286858-11286880 5:11286890-11286912
Sequence CCAGGACACATGCACAAGAACAG GCTGTCTACCAATAAGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 245} {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!