|
Left Crispr |
Right Crispr |
| Crispr ID |
986824061 |
986824070 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:11501686-11501708
|
5:11501711-11501733
|
| Sequence |
CCCTAATGAATGAGATTAGTGCC |
CATAAGAAGGGGCAGGAGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 110, 2: 817, 3: 1563, 4: 2133} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|