ID: 986938328_986938334

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 986938328 986938334
Species Human (GRCh38) Human (GRCh38)
Location 5:12918732-12918754 5:12918780-12918802
Sequence CCACCAAAGCCCAGTAATAGGCC AGTTACCTGAAGAAGATGGCAGG
Strand - +
Off-target summary {0: 13, 1: 161, 2: 162, 3: 88, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!