ID: 986938332_986938334

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 986938332 986938334
Species Human (GRCh38) Human (GRCh38)
Location 5:12918753-12918775 5:12918780-12918802
Sequence CCAAGAGCTGTCTCTCAAAAGAA AGTTACCTGAAGAAGATGGCAGG
Strand - +
Off-target summary {0: 15, 1: 201, 2: 219, 3: 189, 4: 415} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!