|
Left Crispr |
Right Crispr |
Crispr ID |
987007412 |
987007421 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:13724603-13724625
|
5:13724634-13724656
|
Sequence |
CCCCTTCAAATCTCATGTTGAAA |
CCAGTGATGAAAGTGGGGCCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 66, 1: 1021, 2: 1956, 3: 3093, 4: 6601} |
{0: 1, 1: 13, 2: 187, 3: 1403, 4: 3169} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|