|
Left Crispr |
Right Crispr |
Crispr ID |
987016181 |
987016191 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:13822338-13822360
|
5:13822372-13822394
|
Sequence |
CCTCCCAGGCTTAAGTGACCCTC |
TCCAGAGTAGATGGGACTATAGG |
Strand |
- |
+ |
Off-target summary |
{0: 10, 1: 235, 2: 3295, 3: 11051, 4: 46083} |
{0: 7, 1: 474, 2: 13152, 3: 134596, 4: 261264} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|