|
Left Crispr |
Right Crispr |
| Crispr ID |
987016182 |
987016191 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:13822341-13822363
|
5:13822372-13822394
|
| Sequence |
CCCAGGCTTAAGTGACCCTCCCA |
TCCAGAGTAGATGGGACTATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 311, 2: 4781, 3: 20130, 4: 44548} |
{0: 7, 1: 474, 2: 13152, 3: 134596, 4: 261264} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|