ID: 987016182_987016191

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 987016182 987016191
Species Human (GRCh38) Human (GRCh38)
Location 5:13822341-13822363 5:13822372-13822394
Sequence CCCAGGCTTAAGTGACCCTCCCA TCCAGAGTAGATGGGACTATAGG
Strand - +
Off-target summary {0: 13, 1: 311, 2: 4781, 3: 20130, 4: 44548} {0: 7, 1: 474, 2: 13152, 3: 134596, 4: 261264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!