ID: 987016186_987016193

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 987016186 987016193
Species Human (GRCh38) Human (GRCh38)
Location 5:13822360-13822382 5:13822379-13822401
Sequence CCCACCTCAGCATCCAGAGTAGA TAGATGGGACTATAGGCACATGG
Strand - +
Off-target summary No data {0: 1, 1: 14, 2: 146, 3: 540, 4: 1414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!