|
Left Crispr |
Right Crispr |
| Crispr ID |
987024175 |
987024186 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:13907399-13907421
|
5:13907436-13907458
|
| Sequence |
CCAGCCTGGGCAAGAGTGAAACT |
CCCCCCAAAAAAAGAACCTGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 39, 1: 338, 2: 1044, 3: 2590, 4: 8323} |
{0: 1, 1: 1, 2: 2, 3: 37, 4: 271} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|