ID: 987024176_987024186

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 987024176 987024186
Species Human (GRCh38) Human (GRCh38)
Location 5:13907403-13907425 5:13907436-13907458
Sequence CCTGGGCAAGAGTGAAACTCTGT CCCCCCAAAAAAAGAACCTGGGG
Strand - +
Off-target summary {0: 13, 1: 158, 2: 526, 3: 1540, 4: 3408} {0: 1, 1: 1, 2: 2, 3: 37, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!