ID: 987025900_987025910

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 987025900 987025910
Species Human (GRCh38) Human (GRCh38)
Location 5:13926143-13926165 5:13926188-13926210
Sequence CCTGCTGAAAAGAGCCAGACTGG AAGGAGCACCTGAGGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 231} {0: 1, 1: 0, 2: 2, 3: 49, 4: 716}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!