ID: 987082458_987082466

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 987082458 987082466
Species Human (GRCh38) Human (GRCh38)
Location 5:14437815-14437837 5:14437837-14437859
Sequence CCGTAATCCCACCATCCTGGTAG GATTGTAATGATTTGGTTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!