|
Left Crispr |
Right Crispr |
| Crispr ID |
987100013 |
987100022 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:14582697-14582719
|
5:14582729-14582751
|
| Sequence |
CCCAGCTACTCGGAAGGCTGAGG |
TGCTTGAACCCGGCGGGCGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2685, 1: 112021, 2: 295213, 3: 222777, 4: 120667} |
{0: 3, 1: 127, 2: 6331, 3: 40070, 4: 105709} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|