ID: 987128007_987128011

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 987128007 987128011
Species Human (GRCh38) Human (GRCh38)
Location 5:14833425-14833447 5:14833450-14833472
Sequence CCTACCCTGCAGAGCTTGTTAGG CTCAGACATATCAATCTTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111} {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!