ID: 987193252_987193256

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 987193252 987193256
Species Human (GRCh38) Human (GRCh38)
Location 5:15500387-15500409 5:15500403-15500425
Sequence CCCCGGGGCGCGGGCTGTGCGCG GTGCGCGGCGCTGCGCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 191} {0: 1, 1: 0, 2: 2, 3: 19, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!