ID: 987225810_987225815

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 987225810 987225815
Species Human (GRCh38) Human (GRCh38)
Location 5:15840352-15840374 5:15840395-15840417
Sequence CCCTCCTCCTCATTCTTTTCCAA TTACTCTTTCATATGAATTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 121, 4: 1248} {0: 1, 1: 2, 2: 9, 3: 79, 4: 607}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!