ID: 987261674_987261679

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 987261674 987261679
Species Human (GRCh38) Human (GRCh38)
Location 5:16210740-16210762 5:16210773-16210795
Sequence CCCTATCAATAAACTCTTTTTTA TAAGGGTCCAAGGATTCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 79, 4: 765} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!