ID: 987269364_987269378

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 987269364 987269378
Species Human (GRCh38) Human (GRCh38)
Location 5:16290337-16290359 5:16290386-16290408
Sequence CCCCTAATGAAGGAGCACGCCTA CATTGTGGCAGGAGCAGAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 75, 4: 515}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!