ID: 987286712_987286720

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 987286712 987286720
Species Human (GRCh38) Human (GRCh38)
Location 5:16465068-16465090 5:16465111-16465133
Sequence CCTCGCTGTCCTCCTCCTGCTGC CTGTTCAAACCACTGGAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 111, 4: 908} {0: 1, 1: 0, 2: 1, 3: 5, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!