ID: 987288095_987288101

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 987288095 987288101
Species Human (GRCh38) Human (GRCh38)
Location 5:16479895-16479917 5:16479947-16479969
Sequence CCCCATCGAAAGGTAGCAGTGCC ATACTTTTTAATAACATTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 67} {0: 1, 1: 0, 2: 11, 3: 101, 4: 991}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!