|
Left Crispr |
Right Crispr |
| Crispr ID |
987289417 |
987289425 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:16494541-16494563
|
5:16494594-16494616
|
| Sequence |
CCCCCTGCTCTCTCTTACTCCTG |
TCTTTGCCTTCTGCCATGATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 12, 2: 130, 3: 624, 4: 1935} |
{0: 22, 1: 181, 2: 410, 3: 686, 4: 1283} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|