ID: 987292862_987292877

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 987292862 987292877
Species Human (GRCh38) Human (GRCh38)
Location 5:16524844-16524866 5:16524897-16524919
Sequence CCCTGCAGGTGGATGTGCGCGGG CCTGCAGGTGGATGTGCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 8, 4: 90} {0: 3, 1: 2, 2: 3, 3: 19, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!