ID: 987294746_987294752

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 987294746 987294752
Species Human (GRCh38) Human (GRCh38)
Location 5:16539666-16539688 5:16539706-16539728
Sequence CCGGTACCGGGGCCCTGATGTGA GCAGAACTCACACCTCTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 62} {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!