ID: 987330058_987330066

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 987330058 987330066
Species Human (GRCh38) Human (GRCh38)
Location 5:16848656-16848678 5:16848672-16848694
Sequence CCTGGCGATACCTCCCCGCTACG CGCTACGGATGGACGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25} {0: 1, 1: 0, 2: 0, 3: 4, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!