ID: 987336396_987336406

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 987336396 987336406
Species Human (GRCh38) Human (GRCh38)
Location 5:16901348-16901370 5:16901392-16901414
Sequence CCACCCGTGCTGGTTCTACTCTC GCCCAGCAAAGAAGGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 83} {0: 1, 1: 0, 2: 3, 3: 71, 4: 928}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!