ID: 987351866_987351880

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 987351866 987351880
Species Human (GRCh38) Human (GRCh38)
Location 5:17029537-17029559 5:17029589-17029611
Sequence CCCCCAACAATCCCATTAAAAAG GCCTGTAATCCCAGCACTTTGGG
Strand - +
Off-target summary No data {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!