ID: 987351872_987351886

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 987351872 987351886
Species Human (GRCh38) Human (GRCh38)
Location 5:17029548-17029570 5:17029601-17029623
Sequence CCCATTAAAAAGTGGGCAAATGG AGCACTTTGGGAGGCCAAGGCGG
Strand - +
Off-target summary No data {0: 55360, 1: 145174, 2: 158991, 3: 100124, 4: 51656}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!