ID: 987414550_987414556

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 987414550 987414556
Species Human (GRCh38) Human (GRCh38)
Location 5:17649227-17649249 5:17649256-17649278
Sequence CCTCAGCCTCAGTTCCTCCTGCA AAATGGAAAACAGATACCAAAGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 10, 3: 63, 4: 646} {0: 1, 1: 0, 2: 2, 3: 64, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!