ID: 987432758_987432762

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 987432758 987432762
Species Human (GRCh38) Human (GRCh38)
Location 5:17856633-17856655 5:17856650-17856672
Sequence CCAGGCCCCTCTAAAAGAGATTT AGATTTAGAACAAAGACTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 222} {0: 1, 1: 0, 2: 2, 3: 39, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!