ID: 987441924_987441938

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 987441924 987441938
Species Human (GRCh38) Human (GRCh38)
Location 5:17967214-17967236 5:17967253-17967275
Sequence CCCTGCTCCAACCCATGGCTCCT GCCACTGTTTCTCATTGCATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!