ID: 987571119_987571125

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 987571119 987571125
Species Human (GRCh38) Human (GRCh38)
Location 5:19660859-19660881 5:19660906-19660928
Sequence CCACCTGGACTTCTGACCTTCAG GTTTCAAGCCTGAAAGTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 23, 3: 87, 4: 359} {0: 1, 1: 0, 2: 0, 3: 25, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!