ID: 987579996_987580001

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 987579996 987580001
Species Human (GRCh38) Human (GRCh38)
Location 5:19777523-19777545 5:19777568-19777590
Sequence CCGGCCACACTGTGCTTGTGAAG AGAATTAGGGCCTAAATTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 197} {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!