ID: 987605333_987605340

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 987605333 987605340
Species Human (GRCh38) Human (GRCh38)
Location 5:20127231-20127253 5:20127272-20127294
Sequence CCATGTGAGGACATGGTGTTTAC CACTGATTGTAAGTTTTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 273} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!