ID: 987618334_987618341

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 987618334 987618341
Species Human (GRCh38) Human (GRCh38)
Location 5:20305458-20305480 5:20305474-20305496
Sequence CCTCCTCAGCGGCCGCCGCTGCA CGCTGCACTCGCTGGGTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 4, 3: 48, 4: 587} {0: 3, 1: 0, 2: 1, 3: 7, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!