|
Left Crispr |
Right Crispr |
| Crispr ID |
987626551 |
987626556 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:20408134-20408156
|
5:20408158-20408180
|
| Sequence |
CCAAGAATCCCATAACCAGCAAA |
TTGTTCTTCAAAAATGAAGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 60, 3: 567, 4: 8486} |
{0: 1, 1: 0, 2: 9, 3: 60, 4: 528} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|