ID: 987626552_987626556

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 987626552 987626556
Species Human (GRCh38) Human (GRCh38)
Location 5:20408142-20408164 5:20408158-20408180
Sequence CCCATAACCAGCAAAATTGTTCT TTGTTCTTCAAAAATGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 254} {0: 1, 1: 0, 2: 9, 3: 60, 4: 528}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!