ID: 987669246_987669249

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 987669246 987669249
Species Human (GRCh38) Human (GRCh38)
Location 5:20985994-20986016 5:20986019-20986041
Sequence CCAAATTTGGCCTTTTGTCTGTT TGTTAATAAACTTTTATTGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 60, 4: 590} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!