ID: 987675025_987675035

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 987675025 987675035
Species Human (GRCh38) Human (GRCh38)
Location 5:21063399-21063421 5:21063449-21063471
Sequence CCCAGCTCCGGCTATGGCTAAAA CTTCAGAGGGTACAAGCCCCAGG
Strand - +
Off-target summary No data {0: 3, 1: 27, 2: 57, 3: 69, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!