ID: 987692268_987692276 |
View in Genome Browser |
Spacer: 14 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 987692268 | 987692276 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:21282605-21282627 | 5:21282642-21282664 |
| Sequence | CCTCATTCCATCTTTGCATTCAG | TGGTTCATACTGGGGGAACAAGG |
| Strand | - | + |
| Off-target summary | No data | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||