ID: 987694492_987694496

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 987694492 987694496
Species Human (GRCh38) Human (GRCh38)
Location 5:21310564-21310586 5:21310592-21310614
Sequence CCCCTTTCCTATTCTTCACTATT AGCAAAGCTCATAGAATTAGAGG
Strand - +
Off-target summary No data {0: 8, 1: 0, 2: 0, 3: 25, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!